Jatropha Genome Database
- JcCB0171281.10
BLASTN 2.2.23 [Feb-03-2010]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= JcCB0171281.10 + phase: 0 /pseudo/partial
(330 letters)
Database: castor_wgs_0.1_cds
31,221 sequences; 31,347,911 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
30170.m014289 tetracycline transporter, putative 161 3e-39
>30170.m014289 tetracycline transporter, putative
Length = 1329
Score = 161 bits (81), Expect = 3e-39
Identities = 159/185 (85%)
Strand = Plus / Plus
Query: 88 cagggcaaggctcaaggatgcatttcaggcataggttcatttgccaatgtcgtgtctcct 147
||||| ||||||||||||| | ||||||| | || || || |||||||| || || ||
Sbjct: 1087 cagggaaaggctcaaggattcgtttcaggtttgggctcgttagccaatgtggtttcgccc 1146
Query: 148 ttgctgttctctcctttaacagctctgttcctatctgaaagagcaccattccatttccct 207
||| | |||||||||||||||||| |||||||||| |||||||||||||| || ||||||
Sbjct: 1147 ttggttttctctcctttaacagctttgttcctatccgaaagagcaccatttcacttccct 1206
Query: 208 ggtttcagtatcatgtgcgctggattcacctcgatgatagccttgattcagagtatcatg 267
||||||||||| ||||| | |||||| ||||||||||||||||||| |||||||| |||
Sbjct: 1207 ggtttcagtattatgtgtgttggatttgcctcgatgatagccttgatccagagtatgatg 1266
Query: 268 atgag 272
|||||
Sbjct: 1267 atgag 1271