Jatropha Genome Database
- JcCB0158591.10
BLASTN 2.2.23 [Feb-03-2010]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= JcCB0158591.10 + phase: 2 /partial
(247 letters)
Database: castor_wgs_0.1_cds
31,221 sequences; 31,347,911 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
30138.m003942 LIGULELESS1 protein, putative 202 7e-52
>30138.m003942 LIGULELESS1 protein, putative
Length = 1674
Score = 202 bits (102), Expect = 7e-52
Identities = 195/226 (86%)
Strand = Plus / Plus
Query: 20 ttgggctccatactgatacctgatggaagtgatgccataaattttgatgtcacagatggt 79
||||| ||||||||| || ||||||| || |||||||| ||||||| || | |||||
Sbjct: 1444 ttgggatccatactgttatctgatggtagcgatgccatcaattttgtcatcgctgatggg 1503
Query: 80 atttaccaaggatcagattttatgaatgctaagggtagtctttcatgcgaagatggtact 139
|| |||||||||||| ||||||||||||| || | | ||||||| || |||||||| |||
Sbjct: 1504 atgtaccaaggatcaaattttatgaatgcaaaagattgtctttcttgtgaagatggcact 1563
Query: 140 actgttgacttgcttcagctgtcatcacagcttcagcgagtagaacatcagaagcaatcc 199
|| ||||||||||||||||||||||||||||| ||||||| |||| ||||||||||||
Sbjct: 1564 accattgacttgcttcagctgtcatcacagcttgagcgagtggaacgacagaagcaatcc 1623
Query: 200 atgcaagtgaagcaggaaaatgatgctctgtgctggccccacatca 245
||||||||||| ||||||||||||||| | |||||||| |||||||
Sbjct: 1624 atgcaagtgaaacaggaaaatgatgctttctgctggcctcacatca 1669