Jatropha Genome Database

JcCB0156721.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0156721.10 + phase: 0 
         (222 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

30170.m014076 Low-molecular-weight cysteine-rich protein LCR78 p...   115   1e-25

>30170.m014076 Low-molecular-weight cysteine-rich protein LCR78
           precursor, putative
          Length = 240

 Score =  115 bits (58), Expect = 1e-25
 Identities = 145/174 (83%)
 Strand = Plus / Plus

                                                                       
Query: 4   cagagatggcagttacagaagcaaaactttgccaaaggcgcagcaaaacatggtcagggt 63
           ||||||||  ||| ||| |||||||| ||||||| ||||||||||| ||||||||||| |
Sbjct: 65  cagagatgcaagtaacacaagcaaaagtttgccagaggcgcagcaagacatggtcaggat 124

                                                                       
Query: 64  tttgtggagacccaggtaaatgtaatcgtcaatgcaggaattgggaaggtgcttcacatg 123
           ||||||||  | |    || ||| | |||||||||| ||||||||| || || |  ||||
Sbjct: 125 tttgtggaagcacgaagaactgtgaccgtcaatgcaagaattgggagggcgccttgcatg 184

                                                                 
Query: 124 gagcttgtcatgcacaattcccaggatttgcttgtttctgctacttcaaatgtt 177
           ||||||| |||||||| ||||||||| |||| |||||||| |||||||||||||
Sbjct: 185 gagcttgccatgcacagttcccaggagttgcatgtttctgttacttcaaatgtt 238