Jatropha Genome Database
- JcCB0155891.20
BLASTN 2.2.23 [Feb-03-2010]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= JcCB0155891.20 - phase: 2 /TE/partial
(1116 letters)
Database: castor_wgs_0.1_cds
31,221 sequences; 31,347,911 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
30010.m000663 DNA repair helicase rad5,16, putative 172 3e-42
>30010.m000663 DNA repair helicase rad5,16, putative
Length = 2625
Score = 172 bits (87), Expect = 3e-42
Identities = 142/159 (89%), Gaps = 1/159 (0%)
Strand = Plus / Plus
Query: 65 agtccggtgtaaattgtgtccaattggtgggaagcatgtctttgcctgcaagggatgctg 124
|||| ||| |||||||||| ||||| ||||||||||||||||| |||||||| ||| ||
Sbjct: 2228 agtctggtataaattgtgttcaattagtgggaagcatgtctttacctgcaagagataatg 2287
Query: 125 ctatcaagaaatttactgaggatccagattgcaagatcttccttaatgagtttaaaagct 184
||||||||| ||||| |||||||||| ||||||| ||||| |||||||||||| ||||||
Sbjct: 2288 ctatcaagagatttagtgaggatccaaattgcaaaatctt-cttaatgagtttgaaagct 2346
Query: 185 gggggcattgctctcaatctgacagtagcatcacatgtt 223
|| || ||||||||||||||||||||||||||||||||
Sbjct: 2347 ggaggtgttgctctcaatctgacagtagcatcacatgtt 2385
Score = 89.7 bits (45), Expect = 3e-17
Identities = 78/89 (87%)
Strand = Plus / Plus
Query: 703 gttttcttgatggatccttggtggaacccagctgtagaacgtcaagcccaagatagaatt 762
|||||||||||||||||||||||||| |||||||| || || ||||| |||||||||||
Sbjct: 2383 gttttcttgatggatccttggtggaatccagctgtggagcggcaagcacaagatagaata 2442
Query: 763 catcggataggccaatacaaaccaatcag 791
||||| || || || || |||||||||||
Sbjct: 2443 catcgaattgggcagtataaaccaatcag 2471
Score = 75.8 bits (38), Expect = 5e-13
Identities = 53/58 (91%)
Strand = Plus / Plus
Query: 878 agaattgtgagatttatcattgaggacacagttgaggagaggattttgcagctgcaag 935
|||||||||||||| | |||||| ||||| |||||||||||||||||||||||||||
Sbjct: 2470 agaattgtgagattcgttattgagaacacaattgaggagaggattttgcagctgcaag 2527