Jatropha Genome Database

JcCB0155101.20
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0155101.20 + phase: 0 /partial
         (280 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

30147.m013797 Ubiquinone biosynthesis protein coq-8, putative         232   9e-61

>30147.m013797 Ubiquinone biosynthesis protein coq-8, putative
          Length = 1512

 Score =  232 bits (117), Expect = 9e-61
 Identities = 225/261 (86%)
 Strand = Plus / Plus

                                                                       
Query: 14  ttgatttcaaagacattcaagataagctctcctttcactttaggccttggcaacggtcct 73
           ||||||| |||||||| ||| |||| || |||  ||| || || ||||||||||| ||  
Sbjct: 20  ttgattttaaagacatccaatataaactttccactcagttgagaccttggcaacgttctc 79

                                                                       
Query: 74  ttcagttctgggttcgcgcagttgatgtttatactggctacaaggtgtttcaactccgag 133
           |||||||||||||||||||||||||| | ||  |||||||||||||||||||| | ||||
Sbjct: 80  ttcagttctgggttcgcgcagttgatatctacgctggctacaaggtgtttcaagttcgag 139

                                                                       
Query: 134 ttagtttagtgaaggatgtgcaaaagcaggaagcaatgtgggaaaggcagcatgagctgg 193
           | ||||| || |||||||||||||| ||||| ||||||||||||| |||||||||||| |
Sbjct: 140 tgagttttgttaaggatgtgcaaaaacaggaggcaatgtgggaaatgcagcatgagcttg 199

                                                                       
Query: 194 cagctgacaagatttatgccatgtgttctgatcttggtgggttcttcctcaagattgctc 253
           | ||||||||||||||||| |||||||||||||||||||| ||||| || ||| |||| |
Sbjct: 200 ctgctgacaagatttatgctatgtgttctgatcttggtggattctttcttaaggttgccc 259

                                
Query: 254 agatcatagggaagcctgact 274
           |  |||| |||||||||||||
Sbjct: 260 aagtcattgggaagcctgact 280