Jatropha Genome Database
- JcCB0143971.10
BLASTN 2.2.23 [Feb-03-2010]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= JcCB0143971.10 + phase: 0
(795 letters)
Database: castor_wgs_0.1_cds
31,221 sequences; 31,347,911 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
29676.m001650 Polyneuridine-aldehyde esterase precursor, putative 68 9e-11
>29676.m001650 Polyneuridine-aldehyde esterase precursor, putative
Length = 711
Score = 67.9 bits (34), Expect = 9e-11
Identities = 43/46 (93%)
Strand = Plus / Plus
Query: 269 tagcaatggagaattttccagagaaaattttggttgcagtttttgt 314
|||| |||||||| ||||| ||||||||||||||||||||||||||
Sbjct: 191 tagccatggagaactttcctgagaaaattttggttgcagtttttgt 236