Jatropha Genome Database

JcCB0140741.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0140741.10 - phase: 0 
         (636 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

30190.m011121 Dehydration-responsive element-binding protein 1B,...   137   9e-32
30147.m014311 Dehydration-responsive element-binding protein 1B,...    70   2e-11

>30190.m011121 Dehydration-responsive element-binding protein 1B,
           putative
          Length = 738

 Score =  137 bits (69), Expect = 9e-32
 Identities = 189/229 (82%)
 Strand = Plus / Plus

                                                                       
Query: 223 ggaaaatgggtgtctgaaatccgggagccacgcaaaaccacccgtatttggcttggtacc 282
           ||||||||||| || |||||||| |||||||| ||||| || || |||||||| ||||| 
Sbjct: 244 ggaaaatgggtttcagaaatccgcgagccacgtaaaactactcgcatttggctcggtact 303

                                                                       
Query: 283 taccaaacaccagaaatggctgccgcggcctatgatgtggctgcgctagccctaaaaggt 342
           |    |||||| ||||||||||| || || ||||||||||| ||||| ||||||||||||
Sbjct: 304 tttgcaacacctgaaatggctgctgccgcttatgatgtggcggcgcttgccctaaaaggt 363

                                                                       
Query: 343 ggagatgcagtactgaatttccctaattctgttgggtcttatcctgtccccgcttcatcg 402
           ||||||||  | || ||||| ||   ||||||||| ||||||||||| || || || || 
Sbjct: 364 ggagatgccattctcaattttccaggttctgttggttcttatcctgttcctgcatcttct 423

                                                            
Query: 403 tcgccgactgatatacgtaatgcagctgcggctgctgcggcttttaaaa 451
           ||| | |||||||||||||||||||||   |||||||| || |||||||
Sbjct: 424 tcgtctactgatatacgtaatgcagctattgctgctgctgcgtttaaaa 472



 Score =  127 bits (64), Expect = 9e-29
 Identities = 104/116 (89%), Gaps = 1/116 (0%)
 Strand = Plus / Plus

                                                                       
Query: 521 ctgcgagtgatcaagaatttgttgatgaagaggcactttttcgatatgcccaatttgctg 580
           |||| ||||||||||  ||||||||||| || ||| || ||| ||||||| |||||||||
Sbjct: 578 ctgctagtgatcaaggttttgttgatgaggaagca-ttgttccatatgccaaatttgctg 636

                                                                   
Query: 581 gtggatatggcagaaggaatgctgctttcgccgcccagaataacctcctccgatga 636
           ||||||||||||||||||||||||||||||||||| ||||||||||| || |||||
Sbjct: 637 gtggatatggcagaaggaatgctgctttcgccgccaagaataacctcttctgatga 692


>30147.m014311 Dehydration-responsive element-binding protein 1B,
           putative
          Length = 675

 Score = 69.9 bits (35), Expect = 2e-11
 Identities = 59/67 (88%)
 Strand = Plus / Plus

                                                                       
Query: 215 gccggagcggaaaatgggtgtctgaaatccgggagccacgcaaaaccacccgtatttggc 274
           |||||||||| |||||||||||||| ||||| |||||||| ||||| || ||||| ||||
Sbjct: 182 gccggagcgggaaatgggtgtctgagatccgtgagccacgtaaaactacgcgtatatggc 241

                  
Query: 275 ttggtac 281
           | |||||
Sbjct: 242 taggtac 248