Jatropha Genome Database

JcCB0139441.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0139441.10 - phase: 0 /partial
         (726 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

30146.m003440 conserved hypothetical protein                           54   1e-06
29616.m000214 conserved hypothetical protein                           52   5e-06

>30146.m003440 conserved hypothetical protein
          Length = 1086

 Score = 54.0 bits (27), Expect = 1e-06
 Identities = 39/43 (90%)
 Strand = Plus / Plus

                                                      
Query: 223 acaggttgctacaatcttgattgccctggttttgtgcaaacca 265
           |||||||||||| ||||||  |||||||||||||| |||||||
Sbjct: 577 acaggttgctacgatcttgtatgccctggttttgtacaaacca 619



 Score = 52.0 bits (26), Expect = 5e-06
 Identities = 32/34 (94%)
 Strand = Plus / Plus

                                             
Query: 488 atggtcgccatacatctactcaaatgggaagtgg 521
           ||||||||||||| ||||| ||||||||||||||
Sbjct: 842 atggtcgccatacctctacacaaatgggaagtgg 875



 Score = 52.0 bits (26), Expect = 5e-06
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                      
Query: 673  gattttggagttcacttttattatgggggtcctggattttca 714
            |||||||||||||||||||||| ||| ||||| |||| ||||
Sbjct: 1030 gattttggagttcacttttattttggaggtccaggatattca 1071


>29616.m000214 conserved hypothetical protein
          Length = 1206

 Score = 52.0 bits (26), Expect = 5e-06
 Identities = 41/46 (89%)
 Strand = Plus / Plus

                                                          
Query: 503  ctactcaaatgggaagtgggctttttccaggagaagggttcggaaa 548
            ||||||||||||||||||| | |||||| | ||||||||| |||||
Sbjct: 983  ctactcaaatgggaagtggccattttcctgaagaagggtttggaaa 1028