Jatropha Genome Database
- JcCB0139081.10
BLASTN 2.2.23 [Feb-03-2010]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= JcCB0139081.10 + phase: 1 /partial
(422 letters)
Database: castor_wgs_0.1_cds
31,221 sequences; 31,347,911 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
29381.m000075 conserved hypothetical protein 157 6e-38
>29381.m000075 conserved hypothetical protein
Length = 372
Score = 157 bits (79), Expect = 6e-38
Identities = 128/143 (89%), Gaps = 1/143 (0%)
Strand = Plus / Plus
Query: 253 atgggagacactgctcttatttcagaagggtccctgcacgagttttacc-agaaggtgct 311
||||| |||||||||||||||||||||| ||||||| | ||||| |||| ||||||||||
Sbjct: 1 atgggcgacactgctcttatttcagaagagtccctggaagagttctacccagaaggtgct 60
Query: 312 gctgaattgtgtggcatacaaccttcagaagtggcatggttagaagaaactccgcctcca 371
|||||||||||||||||| |||| || ||||| |||||||||||||||||| |||||
Sbjct: 61 gctgaattgtgtggcatagaaccatctgaagtaacatggttagaagaaactcaacctccg 120
Query: 372 gaaaactttgtggtgcagagggg 394
|||||||||||||||||| ||||
Sbjct: 121 gaaaactttgtggtgcagcgggg 143