Jatropha Genome Database

JcCB0131911.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0131911.10 + phase: 1 /partial
         (596 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

30075.m001169 hypothetical protein                                     64   1e-09

>30075.m001169 hypothetical protein
          Length = 1857

 Score = 63.9 bits (32), Expect = 1e-09
 Identities = 59/68 (86%)
 Strand = Plus / Plus

                                                                        
Query: 207  tgtcttggaaagaacagttcaacgaattctgctaataagagctgggcagatatagttgaa 266
            ||||||| ||||||||| |||   || ||||||| |||||||||||||||||| | ||||
Sbjct: 1510 tgtcttgaaaagaacagctcagtaaaatctgctagtaagagctgggcagatatggctgaa 1569

                    
Query: 267  gaagaaga 274
            ||||||||
Sbjct: 1570 gaagaaga 1577



 Score = 54.0 bits (27), Expect = 1e-06
 Identities = 39/43 (90%)
 Strand = Plus / Plus

                                                       
Query: 473  tgtttcacctaggaatccaacagcgcggcgatctttatgtttc 515
            |||||| || ||||||||||||| |||||| ||||||||||||
Sbjct: 1731 tgtttctccaaggaatccaacagtgcggcgttctttatgtttc 1773