Jatropha Genome Database

JcCB0125201.20
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0125201.20 - phase: 0 /partial
         (234 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

29722.m000137 conserved hypothetical protein                           58   2e-08
29646.m001087 conserved hypothetical protein                           56   9e-08
29631.m001054 conserved hypothetical protein                           50   6e-06
29726.m003931 conserved hypothetical protein                           50   6e-06
29839.m000436 conserved hypothetical protein                           50   6e-06

>29722.m000137 conserved hypothetical protein
          Length = 1218

 Score = 58.0 bits (29), Expect = 2e-08
 Identities = 53/61 (86%)
 Strand = Plus / Plus

                                                                        
Query: 62   tggacattacaatgctatctgagcagagaaaagattgccacccatcaatatatagcggtg 121
            ||||||| |||||||| || || |  |||||||| |||||||||||||| ||||||||||
Sbjct: 1043 tggacatcacaatgctctcagaactaagaaaagactgccacccatcaatttatagcggtg 1102

             
Query: 122  a 122
            |
Sbjct: 1103 a 1103


>29646.m001087 conserved hypothetical protein
          Length = 1053

 Score = 56.0 bits (28), Expect = 9e-08
 Identities = 40/44 (90%)
 Strand = Plus / Plus

                                                        
Query: 163  gattgtagccattggtgccttcctggacttcctgatacttggaa 206
            ||||||||||||||||| || |||||| | ||||||||||||||
Sbjct: 979  gattgtagccattggtgtctgcctggattgcctgatacttggaa 1022


>29631.m001054 conserved hypothetical protein
          Length = 1746

 Score = 50.1 bits (25), Expect = 6e-06
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                 
Query: 163  gattgtagccattggtgccttcctggacttcctgatacttggaatgaattatt 215
            ||||| || ||||||||| | |||||| | || ||||||||||||||||||||
Sbjct: 1648 gattgcagtcattggtgcttacctggagtgccagatacttggaatgaattatt 1700


>29726.m003931 conserved hypothetical protein
          Length = 1083

 Score = 50.1 bits (25), Expect = 6e-06
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                     
Query: 166  tgtagccattggtgccttcctggacttcctgatacttggaa 206
            |||||||||||||||||  ||||| |||||||| |||||||
Sbjct: 997  tgtagccattggtgcctcgctggagttcctgatgcttggaa 1037


>29839.m000436 conserved hypothetical protein
          Length = 1140

 Score = 50.1 bits (25), Expect = 6e-06
 Identities = 43/49 (87%)
 Strand = Plus / Plus

                                                             
Query: 161  ctgattgtagccattggtgccttcctggacttcctgatacttggaatga 209
            |||| |||||||||||||||||||||||  | |||||||  ||||||||
Sbjct: 1070 ctgactgtagccattggtgccttcctggggtacctgatatctggaatga 1118