Jatropha Genome Database
- JcCB0124021.10
BLASTN 2.2.23 [Feb-03-2010]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= JcCB0124021.10 + phase: 0 /pseudo/partial
(366 letters)
Database: castor_wgs_0.1_cds
31,221 sequences; 31,347,911 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
29682.m000600 protein kinase, putative 200 4e-51
>29682.m000600 protein kinase, putative
Length = 2433
Score = 200 bits (101), Expect = 4e-51
Identities = 164/185 (88%)
Strand = Plus / Plus
Query: 172 tgcacactaaatagaccatgggaaggagtgccgccggaaagggtagtttatgccgttgct 231
||||||||||| |||||||||||||||||||| || |||||||| || ||||| ||||||
Sbjct: 2236 tgcacactaaacagaccatgggaaggagtgccaccagaaagggttgtatatgctgttgct 2295
Query: 232 aatgagggatcacgattggagattcctgaaggtccactgggcaggttaatttcagattgt 291
|||||| |||| || ||||| ||||| ||||||||||| ||||||||||||||||||||
Sbjct: 2296 aatgagcgatcccgtttggatattccggaaggtccacttggcaggttaatttcagattgc 2355
Query: 292 tgggcagaaccccatgaacgaccaagctgcgaagagatactctcccggttgctggattgc 351
|||| |||||| |||||||| |||||||| |||||||||||| |||| ||||| || |||
Sbjct: 2356 tggggagaaccacatgaacggccaagctgtgaagagatactcgcccgtttgctcgactgc 2415
Query: 352 gagta 356
|||||
Sbjct: 2416 gagta 2420
Score = 133 bits (67), Expect = 8e-31
Identities = 130/143 (90%), Gaps = 6/143 (4%)
Strand = Plus / Plus
Query: 27 tgcatgaagccgtcctcacttgtctaatggttacttgaatatatggaggatggggtccgt 86
||||||||||| ||||||||| || ||||||||| |||||||||||| ||||| || |
Sbjct: 1852 tgcatgaagcc-tcctcacttatc-aatggttacg-gaatatatggag-atgggttca-t 1906
Query: 87 tgtattatttgatccatttgagtggtcagaagaagaggcttagttggagaaggaagctaa 146
||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||
Sbjct: 1907 tgtattatttgatccatttgagtggtcagaagaagaggcttagttggaggaggaaactaa 1966
Query: 147 aaatgttgcgagattatatgcag 169
|||||||||| || |||||||||
Sbjct: 1967 aaatgttgcgtga-tatatgcag 1988