Jatropha Genome Database

JcCB0122531.20
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0122531.20 - phase: 1 /partial
         (410 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

29686.m000873 conserved hypothetical protein                          226   8e-59

>29686.m000873 conserved hypothetical protein
          Length = 1881

 Score =  226 bits (114), Expect = 8e-59
 Identities = 236/276 (85%), Gaps = 3/276 (1%)
 Strand = Plus / Plus

                                                                        
Query: 134  gatgccagagtttgactataacagtatagattggactttggataataatatgttatcatc 193
            |||||| ||||||||||| | |||||||||||||||||||||||  ||  ||| ||| ||
Sbjct: 1605 gatgcccgagtttgactacaccagtatagattggactttggatacaaacctgtcatcctc 1664

                                                                        
Query: 194  caaaccaagcgggttgtggctggggctttcctcattattgaggaacagttccggcacaag 253
             || |   | ||| |||||||||| ||||| ||||| |||||  |||| || ||| ||||
Sbjct: 1665 taagc---gggggctgtggctgggtctttcttcattgttgagcgacagatctggcgcaag 1721

                                                                        
Query: 254  aatgaacagtatgaatagttcctgcatatcagggttacgggacgctggggctactaaaga 313
             ||||||||||||||||||||||||||||||||||||||||| ||||||||  |||||||
Sbjct: 1722 gatgaacagtatgaatagttcctgcatatcagggttacgggaagctggggcagctaaaga 1781

                                                                        
Query: 314  aacgtcatcttctgctggtttgcacgagtggacatcgccttttgcagggaaggacatatt 373
            || | | ||||||| ||||||||  |||||||| || |||||||||||||||||||||||
Sbjct: 1782 aatggcttcttctgttggtttgcgtgagtggacgtctccttttgcagggaaggacatatt 1841

                                                
Query: 374  tagtttgcctagacagtttgttacttctccttctcc 409
            |||| ||||||| |||||||| |||||||| |||||
Sbjct: 1842 tagtctgcctaggcagtttgtcacttctccatctcc 1877