Jatropha Genome Database

JcCB0117851.20
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0117851.20 + phase: 0 /partial
         (177 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

29696.m000106 actin binding protein, putative                         161   2e-39
29848.m004543 DNA binding protein, putative                            62   1e-09
30138.m004035 conserved hypothetical protein                           62   1e-09

>29696.m000106 actin binding protein, putative
          Length = 3576

 Score =  161 bits (81), Expect = 2e-39
 Identities = 126/141 (89%)
 Strand = Plus / Plus

                                                                        
Query: 1    agttcggtgcttgctcttgaggattcggcattagatgtagatcaggttgacaaccttata 60
            ||||| |||||||| ||||||||| | |||||||||||||||||  |||| ||||| || 
Sbjct: 2626 agttcagtgcttgcgcttgaggatacagcattagatgtagatcaacttgagaacctcatc 2685

                                                                        
Query: 61   aaattttgtccaacaaaagaggagatggaacttcttaagggctacactggagaaaaggaa 120
            || || |||||||||||||||||||||||||| ||||||||||||| |||||||||||||
Sbjct: 2686 aagttctgtccaacaaaagaggagatggaactacttaagggctacattggagaaaaggaa 2745

                                 
Query: 121  aaattaggaaaatgtgaacag 141
            ||  |||||||||||||||||
Sbjct: 2746 aagctaggaaaatgtgaacag 2766


>29848.m004543 DNA binding protein, putative
          Length = 3801

 Score = 61.9 bits (31), Expect = 1e-09
 Identities = 52/59 (88%)
 Strand = Plus / Plus

                                                                       
Query: 32   tagatgtagatcaggttgacaaccttataaaattttgtccaacaaaagaggagatggaa 90
            ||||||| ||||||||||| || |||||||| || |||||||| ||||| |||||||||
Sbjct: 2870 tagatgttgatcaggttgataatcttataaagttctgtccaactaaagaagagatggaa 2928


>30138.m004035 conserved hypothetical protein
          Length = 4653

 Score = 61.9 bits (31), Expect = 1e-09
 Identities = 73/87 (83%)
 Strand = Plus / Plus

                                                                        
Query: 55   cttataaaattttgtccaacaaaagaggagatggaacttcttaagggctacactggagaa 114
            ||||||||||| ||||| || |||||||||||||||||||| |||   ||| ||||||| 
Sbjct: 3778 cttataaaattctgtcctacgaaagaggagatggaacttctcaagaattactctggagac 3837

                                       
Query: 115  aaggaaaaattaggaaaatgtgaacag 141
            || |||||  | ||||| |||||||||
Sbjct: 3838 aaagaaaacctgggaaagtgtgaacag 3864