Jatropha Genome Database

JcCB0115521.20
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0115521.20 + phase: 0 /partial/short
         (114 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

28200.m000196 trehalose-6-phosphate synthase, putative                113   2e-25

>28200.m000196 trehalose-6-phosphate synthase, putative
          Length = 1188

 Score =  113 bits (57), Expect = 2e-25
 Identities = 81/89 (91%)
 Strand = Plus / Plus

                                                                        
Query: 19   aaaggttatggcattctggtatcttctacaccgaaagaaaccaacgctttttattccctg 78
            |||||||||||||||||||| ||| ||  ||||||||||||||| || ||||| ||| ||
Sbjct: 1030 aaaggttatggcattctggtgtctcctgtaccgaaagaaaccaatgccttttactccttg 1089

                                         
Query: 79   agggatccaacagaggtaatgaaatttct 107
            |||||||||||||||||||||||||||||
Sbjct: 1090 agggatccaacagaggtaatgaaatttct 1118