Jatropha Genome Database
- JcCB0109541.20
BLASTN 2.2.23 [Feb-03-2010]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= JcCB0109541.20 + phase: 1 /pseudo/partial
(240 letters)
Database: castor_wgs_0.1_cds
31,221 sequences; 31,347,911 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
29830.m001424 Adipocyte plasma membrane-associated protein, puta... 66 1e-10
>29830.m001424 Adipocyte plasma membrane-associated protein,
putative
Length = 1143
Score = 65.9 bits (33), Expect = 1e-10
Identities = 87/105 (82%)
Strand = Plus / Plus
Query: 130 ggacccgaagatatagcatatgacagcaagtcggggctgatttacacgagctgtcaagat 189
||||| |||||||| |||| |||||||||||| ||||| ||||| || || ||| ||
Sbjct: 250 ggaccagaagatattgcatttgacagcaagtcagggctcatttatacaagttgtgcaggc 309
Query: 190 gggtggatcaagcgagtcacggtgaatgactcggtgtctgactcg 234
|||||||| |||||||| || || || ||||||||| ||||||||
Sbjct: 310 gggtggataaagcgagttacagtcaacgactcggtgactgactcg 354