Jatropha Genome Database

JcCB0108291.30
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0108291.30 + phase: 0 
         (282 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

29092.m000450 C-14 sterol reductase, putative                         186   5e-47

>29092.m000450 C-14 sterol reductase, putative
          Length = 849

 Score =  186 bits (94), Expect = 5e-47
 Identities = 136/150 (90%)
 Strand = Plus / Plus

                                                                       
Query: 90  tggatctatattgcctggtaaagttgttcctggagtgaccctgcaggatggttctcgtct 149
           |||||||||||||||||| ||| ||||||||||||||| | |||||||||||||||| ||
Sbjct: 90  tggatctatattgcctggcaaacttgttcctggagtgatcttgcaggatggttctcgact 149

                                                                       
Query: 150 ctattatcgttgcaatgggttggtatcgttgctgttgctggtcgctcttcttgggattgg 209
           |||||||||||||||||||||| | || |||||||||||||| |||||||||||||||||
Sbjct: 150 ctattatcgttgcaatgggttgttgtcattgctgttgctggttgctcttcttgggattgg 209

                                         
Query: 210 cgctaagatggatcttgtatcacccactgt 239
             ||||  |||||||| |||||||||||||
Sbjct: 210 tactaaattggatcttatatcacccactgt 239