Jatropha Genome Database
- JcCB0102141.10
BLASTN 2.2.23 [Feb-03-2010]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= JcCB0102141.10 - phase: 0 /partial
(475 letters)
Database: castor_wgs_0.1_cds
31,221 sequences; 31,347,911 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
30169.m006480 hypothetical protein 84 9e-16
>30169.m006480 hypothetical protein
Length = 5748
Score = 83.8 bits (42), Expect = 9e-16
Identities = 138/170 (81%)
Strand = Plus / Plus
Query: 58 ggagttgtgcaatcctacgacccatcgtctggcttctttgagatcgtttacgaagacggc 117
||||| || ||||| |||||| | |||||||| || || ||||||||||||| ||||||
Sbjct: 58 ggagtagttcaatcgtacgacgcgtcgtctggattattcgagatcgtttacggggacggc 117
Query: 118 gattccgaggagcttgatttctcggaagtcgtttccttgttggagcggaaagaagctgtg 177
||||| || || |||||||| || ||||| | ||| ||||| |||| || ||||||||
Sbjct: 118 gattctgaagaacttgatttttctgaagttgcttctttgttagagcagacagaagctgaa 177
Query: 178 ccagttgatcacaagcatcgactcggtcgtaggcctaagaagcgacgtcg 227
|| | ||| || |||| ||| || |||||||| ||||||||||| |||||
Sbjct: 178 ccgggtgagcataagcctcggcttggtcgtagacctaagaagcggcgtcg 227