Jatropha Genome Database

JcCB0101051.30
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0101051.30 - phase: 0 
         (693 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

30147.m014475 conserved hypothetical protein                           80   2e-14

>30147.m014475 conserved hypothetical protein
          Length = 780

 Score = 79.8 bits (40), Expect = 2e-14
 Identities = 210/266 (78%), Gaps = 3/266 (1%)
 Strand = Plus / Plus

                                                                       
Query: 37  cagcagtacaagcatttgcaacaagaatgggactccataaaaaattcaaaaccaagaacc 96
           ||||||||||||  ||||||| || ||||| ||||||||||| | ||||||| |||||||
Sbjct: 49  cagcagtacaagagtttgcaagaaaaatggtactccataaaacaatcaaaactaagaacc 108

                                                                       
Query: 97  ttacgcagatcagcaactgactcaagaaccattcttaaaggtcttaaacttttcgataat 156
           ||||| ||||||  ||| || || |||||||||  || ||| ||| |  |  | || |||
Sbjct: 109 ttacgtagatcactaacagattccagaaccattgatagaggcctttatttccttgacaat 168

                                                                       
Query: 157 tctccaagaaagctaatgtcttcacttcaacatactaggtcgtctttagacaatggagaa 216
           ||||||||||| || ||||||| |||||| || |  |||||  | | ||     |||| |
Sbjct: 169 tctccaagaaaactcatgtctttacttcagcacaggaggtcaccatcag---gaggagca 225

                                                                       
Query: 217 tggaaagtgagggacaatgacttggctgttgttgagattttgagagagagaagggctgcc 276
           ||||| |||||| ||||||||||||| ||||| ||||| || ||||| |||| ||| |||
Sbjct: 226 tggaaggtgaggaacaatgacttggcagttgtggagatattaagagaaagaaaggcagcc 285

                                     
Query: 277 attcaaagtggcaagttgaagggaag 302
           ||| | || |||||| | ||||||||
Sbjct: 286 attaagagcggcaagattaagggaag 311