Jatropha Genome Database
- JcCB0100521.10
BLASTN 2.2.23 [Feb-03-2010]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= JcCB0100521.10 - phase: 0 /partial
(321 letters)
Database: castor_wgs_0.1_cds
31,221 sequences; 31,347,911 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
29646.m001073 nucleic acid binding protein, putative 337 2e-92
>29646.m001073 nucleic acid binding protein, putative
Length = 1563
Score = 337 bits (170), Expect = 2e-92
Identities = 275/310 (88%)
Strand = Plus / Plus
Query: 8 ctcagcaagacaatatgcaatggggccataggcaaattgagcctgagaatacctcagtca 67
||||||||||||||||||||||||| ||||||| | | |||||||| || | |||||| |
Sbjct: 1247 ctcagcaagacaatatgcaatggggtcataggcgagtggagcctgaaaacagctcagtta 1306
Query: 68 ctgcagggctgggacttggtttaccttgtgatggaggttctgggttaaaggaattgatga 127
|||| ||||| |||||||| |||||||||||||||||||| || ||||||||||||||||
Sbjct: 1307 ctgctgggctaggacttggattaccttgtgatggaggttcaggattaaaggaattgatga 1366
Query: 128 tgggaactccctctgtttttggtcctaagcaaacaacccttgatttccttggattgggta 187
||| |||||| ||||||||||||||||||||||| ||||||||||| ||||||||||| |
Sbjct: 1367 tggcaactccttctgtttttggtcctaagcaaactacccttgattttcttggattgggaa 1426
Query: 188 tggctgctggtggaagccctagtagtggtttgtcagctctaattacttctattggtagtg 247
|||||||||||||| | |||| |||| |||||||||||||||| |||||||||||||
Sbjct: 1427 tggctgctggtggaggttctagcggtggcctgtcagctctaattacgtctattggtagtg 1486
Query: 248 gcatggatgtggctgccgcagcagcttcttttggaggcggagaatattctggcaaagacc 307
| | ||||| ||||| |||||||| ||||||||||||||||||| |||||| ||||||
Sbjct: 1487 gtctagatgtagctgctgcagcagcctcttttggaggcggagaattttctggaaaagaca 1546
Query: 308 tgggaaggag 317
||||||||||
Sbjct: 1547 tgggaaggag 1556