Jatropha Genome Database

JcCB0100471.20
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0100471.20 + phase: 0 /partial
         (295 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

29842.m003533 50S ribosomal protein L4, putative                       78   3e-14

>29842.m003533 50S ribosomal protein L4, putative
          Length = 885

 Score = 77.8 bits (39), Expect = 3e-14
 Identities = 75/87 (86%)
 Strand = Plus / Plus

                                                                       
Query: 202 tcaacatctattctgactcctggatcaagtgatggtgcattcccctcagatttgttatcc 261
           |||||||||||  ||||||| ||||| ||||||| |||||| |||||||||||||| || 
Sbjct: 139 tcaacatctatcttgactccaggatctagtgatgatgcatttccctcagatttgttgtct 198

                                      
Query: 262 acaaaggctgtgctaacaccagagcgt 288
           |||||| || | || ||||||||||||
Sbjct: 199 acaaagactttacttacaccagagcgt 225



 Score = 50.1 bits (25), Expect = 7e-06
 Identities = 43/49 (87%)
 Strand = Plus / Plus

                                                           
Query: 1  atggcagtgtcaatatcgagaaggattttacgttctcttgggtccttac 49
          ||||||||||| |||||  ||||||||||||| ||| || |||||||||
Sbjct: 1  atggcagtgtcgatatctcgaaggattttacgctcttttaggtccttac 49