Jatropha Genome Database

JcCB0097241.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0097241.10 + phase: 0 
         (231 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

30068.m002600 conserved hypothetical protein                           72   2e-12

>30068.m002600 conserved hypothetical protein
          Length = 240

 Score = 71.9 bits (36), Expect = 2e-12
 Identities = 72/84 (85%)
 Strand = Plus / Plus

                                                                      
Query: 1  atgaattccatctttagctccttcgatgctctctgcgccgaattgttaggccaaacaatc 60
          ||||||||||| ||||||||||||||||  |||||||  ||||| || |||||||| || 
Sbjct: 1  atgaattccatgtttagctccttcgatgtactctgcggtgaattcttgggccaaactata 60

                                  
Query: 61 aagtcctcttttgcatctgcaact 84
          | |||| ||||||| |||||||||
Sbjct: 61 aggtccccttttgcttctgcaact 84



 Score = 52.0 bits (26), Expect = 1e-06
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 178 tttgcaccggagcttgatggcctcaactgtttcgagac 215
           ||||| |||||||||||||| || ||||||||||||||
Sbjct: 187 tttgccccggagcttgatgggcttaactgtttcgagac 224