Jatropha Genome Database

JcCB0096691.20
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0096691.20 - phase: 0 
         (1134 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

30170.m013673 conserved hypothetical protein                           82   8e-15
28976.m000158 conserved hypothetical protein                           80   3e-14
44978.m000014 conserved hypothetical protein                           72   8e-12
30068.m002588 conserved hypothetical protein                           56   5e-07
29706.m001283 conserved hypothetical protein                           52   7e-06

>30170.m013673 conserved hypothetical protein
          Length = 1854

 Score = 81.8 bits (41), Expect = 8e-15
 Identities = 107/129 (82%)
 Strand = Plus / Plus

                                                                       
Query: 568 cctggacgatgtcggagaacagatggaaagaaatggcgatgctcaagggatactgttgcg 627
           ||||| || ||||| || |||||||| || |||||||| |||||||| ||| | ||||| 
Sbjct: 676 cctgggcgttgtcgcaggacagatgggaaaaaatggcggtgctcaagagatgcggttgcc 735

                                                                       
Query: 628 gaccaaaaatactgcgaaaaacatatgaacagaggccgctatcgttcaagaaagcctgtg 687
           ||||| |||||||| ||    ||||||||||| |||||  ||||||||||||||| ||||
Sbjct: 736 gaccagaaatactgtgagcggcatatgaacaggggccgtcatcgttcaagaaagcatgtg 795

                    
Query: 688 gaagcccaa 696
           |||| ||||
Sbjct: 796 gaaggccaa 804


>28976.m000158 conserved hypothetical protein
          Length = 1296

 Score = 79.8 bits (40), Expect = 3e-14
 Identities = 112/136 (82%)
 Strand = Plus / Plus

                                                                       
Query: 563 ctgaacctggacgatgtcggagaacagatggaaagaaatggcgatgctcaagggatactg 622
           |||| |||||| | |||||  |||| || |||||||||||||| || |||| |||   ||
Sbjct: 575 ctgagcctggaaggtgtcgtcgaaccgacggaaagaaatggcggtgttcaaaggacgttg 634

                                                                       
Query: 623 ttgcggaccaaaaatactgcgaaaaacatatgaacagaggccgctatcgttcaagaaagc 682
           || | |||||||||||||| ||||  || || || ||||| ||| |||||||||||||||
Sbjct: 635 ttcctgaccaaaaatactgtgaaaggcacattaatagaggtcgccatcgttcaagaaagc 694

                           
Query: 683 ctgtggaagcccaaac 698
           ||||||||| ||||||
Sbjct: 695 ctgtggaaggccaaac 710


>44978.m000014 conserved hypothetical protein
          Length = 1059

 Score = 71.9 bits (36), Expect = 8e-12
 Identities = 39/40 (97%)
 Strand = Plus / Plus

                                                   
Query: 652 atgaacagaggccgctatcgttcaagaaagcctgtggaag 691
           ||||||||||||||| ||||||||||||||||||||||||
Sbjct: 1   atgaacagaggccgccatcgttcaagaaagcctgtggaag 40


>30068.m002588 conserved hypothetical protein
          Length = 1524

 Score = 56.0 bits (28), Expect = 5e-07
 Identities = 31/32 (96%)
 Strand = Plus / Plus

                                           
Query: 583 agaacagatggaaagaaatggcgatgctcaag 614
           ||||||||||||||||||||| ||||||||||
Sbjct: 598 agaacagatggaaagaaatggagatgctcaag 629


>29706.m001283 conserved hypothetical protein
          Length = 1023

 Score = 52.0 bits (26), Expect = 7e-06
 Identities = 47/54 (87%)
 Strand = Plus / Plus

                                                                 
Query: 637 tactgcgaaaaacatatgaacagaggccgctatcgttcaagaaagcctgtggaa 690
           ||||| |||| ||||||| | |||||| |  |||||||||||||||||||||||
Sbjct: 307 tactgtgaaagacatatgcatagaggcagaaatcgttcaagaaagcctgtggaa 360