Jatropha Genome Database

JcCB0096691.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0096691.10 - phase: 1 /pseudo/partial
         (346 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

44978.m000014 conserved hypothetical protein                           64   6e-10
30068.m002588 conserved hypothetical protein                           56   1e-07
30190.m011066 conserved hypothetical protein                           54   6e-07
30170.m013673 conserved hypothetical protein                           54   6e-07
29706.m001283 conserved hypothetical protein                           52   2e-06
30174.m008910 conserved hypothetical protein                           50   9e-06

>44978.m000014 conserved hypothetical protein
          Length = 1059

 Score = 63.9 bits (32), Expect = 6e-10
 Identities = 38/40 (95%)
 Strand = Plus / Plus

                                                   
Query: 121 atgaacagaggccggtatcgttcaagaaagcctgtggaag 160
           ||||||||||||||  ||||||||||||||||||||||||
Sbjct: 1   atgaacagaggccgccatcgttcaagaaagcctgtggaag 40


>30068.m002588 conserved hypothetical protein
          Length = 1524

 Score = 56.0 bits (28), Expect = 1e-07
 Identities = 31/32 (96%)
 Strand = Plus / Plus

                                           
Query: 51  agaacagatggaaagaaatggcgatgctcaag 82
           ||||||||||||||||||||| ||||||||||
Sbjct: 598 agaacagatggaaagaaatggagatgctcaag 629


>30190.m011066 conserved hypothetical protein
          Length = 702

 Score = 54.0 bits (27), Expect = 6e-07
 Identities = 57/67 (85%)
 Strand = Plus / Plus

                                                                       
Query: 95  ctgaccaaaagtatcgtgaaaaacatatgaacagaggccggtatcgttcaagaaagcctg 154
           |||| ||||||||| |||||| ||| ||| ||||||| ||  | ||||||||||||| ||
Sbjct: 485 ctgatcaaaagtattgtgaaagacacatgcacagagggcgccagcgttcaagaaagcttg 544

                  
Query: 155 tggaagc 161
           |||||||
Sbjct: 545 tggaagc 551


>30170.m013673 conserved hypothetical protein
          Length = 1854

 Score = 54.0 bits (27), Expect = 6e-07
 Identities = 39/43 (90%)
 Strand = Plus / Plus

                                                      
Query: 118 catatgaacagaggccggtatcgttcaagaaagcctgtggaag 160
           ||||||||||| |||||  ||||||||||||||| ||||||||
Sbjct: 757 catatgaacaggggccgtcatcgttcaagaaagcatgtggaag 799


>29706.m001283 conserved hypothetical protein
          Length = 1023

 Score = 52.0 bits (26), Expect = 2e-06
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                             
Query: 110 gtgaaaaacatatgaacagaggccggtatcgttcaagaaagcctgtggaa 159
           |||||| ||||||| | |||||| |  |||||||||||||||||||||||
Sbjct: 311 gtgaaagacatatgcatagaggcagaaatcgttcaagaaagcctgtggaa 360


>30174.m008910 conserved hypothetical protein
          Length = 1311

 Score = 50.1 bits (25), Expect = 9e-06
 Identities = 34/37 (91%)
 Strand = Plus / Plus

                                                
Query: 125 acagaggccggtatcgttcaagaaagcctgtggaagc 161
           ||||||||||  | |||||||||||||||||||||||
Sbjct: 410 acagaggccgtcaccgttcaagaaagcctgtggaagc 446