Jatropha Genome Database

JcCB0094891.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0094891.10 - phase: 0 /pseudo
         (456 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

30131.m007258 conserved hypothetical protein                          129   2e-29

>30131.m007258 conserved hypothetical protein
          Length = 1323

 Score =  129 bits (65), Expect = 2e-29
 Identities = 120/137 (87%), Gaps = 1/137 (0%)
 Strand = Plus / Plus

                                                                       
Query: 320 ttcttcattcatatcagtcagcagaattggcaaagggtcctaaaccaactgcattgacaa 379
           ||||| ||||||| ||||| ||||| |||||||| || ||| ||||||||||||| ||||
Sbjct: 326 ttcttaattcataccagtctgcagagttggcaaaagggcctcaaccaactgcatttacaa 385

                                                                       
Query: 380 ataaaaatctctacttccgcccctgatgtcttgtacagatggcatttgccagagccagat 439
           | |||| || |||||||| | ||||||||  |||| |||||||||||||| |||||||||
Sbjct: 386 acaaaa-tccctacttcccctcctgatgtactgtatagatggcatttgcctgagccagat 444

                            
Query: 440 gctattgatgtttctgg 456
           |||||||||||||||||
Sbjct: 445 gctattgatgtttctgg 461