Jatropha Genome Database

JcCB0080921.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0080921.10 - phase: 0 
         (1446 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

27561.m000296 UDP-glucuronosyltransferase, putative                    70   4e-11
27561.m000297 UDP-glucuronosyltransferase, putative                    68   2e-10
29806.m000964 UDP-glucuronosyltransferase, putative                    58   2e-07
27956.m000350 UDP-glucuronosyltransferase, putative                    56   6e-07

>27561.m000296 UDP-glucuronosyltransferase, putative
          Length = 1416

 Score = 69.9 bits (35), Expect = 4e-11
 Identities = 50/55 (90%)
 Strand = Plus / Plus

                                                                  
Query: 70  atgcaacttgctaagcttttgcattcaagaggctatcatataacctttgtaaaca 124
           ||||||||||| |||||||||||||||||||| | ||| ||||||||||| ||||
Sbjct: 76  atgcaacttgccaagcttttgcattcaagaggatttcacataacctttgtcaaca 130



 Score = 67.9 bits (34), Expect = 2e-10
 Identities = 52/58 (89%)
 Strand = Plus / Plus

                                                                     
Query: 937 aaagagtttgcatggggacttgcaaatagtaaacatccatttttgtggataattaggc 994
           ||||| ||||||||||| ||||| ||||| ||||| ||||||||||||||||| ||||
Sbjct: 934 aaagaatttgcatggggccttgctaatagcaaacacccatttttgtggataataaggc 991


>27561.m000297 UDP-glucuronosyltransferase, putative
          Length = 1215

 Score = 67.9 bits (34), Expect = 2e-10
 Identities = 52/58 (89%)
 Strand = Plus / Plus

                                                                     
Query: 937 aaagagtttgcatggggacttgcaaatagtaaacatccatttttgtggataattaggc 994
           ||||| ||||||||||| ||||| ||||| ||||| ||||||||||||||||| ||||
Sbjct: 778 aaagaatttgcatggggccttgctaatagcaaacacccatttttgtggataataaggc 835



 Score = 61.9 bits (31), Expect = 1e-08
 Identities = 49/55 (89%)
 Strand = Plus / Plus

                                                                  
Query: 70  atgcaacttgctaagcttttgcattcaagaggctatcatataacctttgtaaaca 124
           ||||||||||| |||||| ||||||||||||| | ||| ||||||||||| ||||
Sbjct: 76  atgcaacttgccaagcttctgcattcaagaggatttcacataacctttgtcaaca 130


>29806.m000964 UDP-glucuronosyltransferase, putative
          Length = 1425

 Score = 58.0 bits (29), Expect = 2e-07
 Identities = 47/53 (88%)
 Strand = Plus / Plus

                                                                
Query: 944 ttgcatggggacttgcaaatagtaaacatccatttttgtggataattaggcct 996
           |||| ||||||||||| ||||| ||| || ||||||||||| |||||||||||
Sbjct: 932 ttgcttggggacttgctaatagcaaatattcatttttgtgggtaattaggcct 984


>27956.m000350 UDP-glucuronosyltransferase, putative
          Length = 1452

 Score = 56.0 bits (28), Expect = 6e-07
 Identities = 55/64 (85%)
 Strand = Plus / Plus

                                                                       
Query: 206 ctattcctgacgggctgcctccgtctaaccctgatgccacgcaagacatcccttctcttt 265
           ||||||||||||| || ||||| ||| | |||||| |||| ||||| || ||||||||||
Sbjct: 215 ctattcctgacggtcttcctccttctgatcctgattccacccaagatataccttctcttt 274

               
Query: 266 gtga 269
           ||||
Sbjct: 275 gtga 278