Jatropha Genome Database

JcCB0080131.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0080131.10 + phase: 0 /partial
         (630 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

29680.m001687 conserved hypothetical protein                          418   e-116

>29680.m001687 conserved hypothetical protein
          Length = 636

 Score =  418 bits (211), Expect = e-116
 Identities = 334/375 (89%)
 Strand = Plus / Plus

                                                                       
Query: 34  gagaataaaaggctggtttgcgttgctgcatctgcagcaggaagttctagtccagatagt 93
           |||||||||| ||||||||| | ||||||||||||||||||||| || |||||||| || 
Sbjct: 127 gagaataaaaagctggtttgtgctgctgcatctgcagcaggaagctccagtccagacagc 186

                                                                       
Query: 94  gacctaaacccatatgaggtccttggcgtgagcccctttgaggggtttgacaaagtgaag 153
           ||||||||||| |||||||||||||| |||||| || | ||||||||||||   || |||
Sbjct: 187 gacctaaacccctatgaggtccttggtgtgagctccatcgaggggtttgacgtggtcaag 246

                                                                       
Query: 154 gcagcatatacaaaaaagctcaaggaggctgagagcataggtgatgaagtgactgcttct 213
           |||  |||||||||||||| ||| || |||||||  |||||||||||||  ||| || ||
Sbjct: 247 gcaaaatatacaaaaaagcgcaaagaagctgagatgataggtgatgaagcaactactgct 306

                                                                       
Query: 214 ctgcttgaaaaggcgtatgataaactgatgatgtcacagttaacaagtcgtaagaagggt 273
           | |||||| ||||| ||||||||||||||||||||||| ||||| ||||| |||||||||
Sbjct: 307 cggcttgagaaggcatatgataaactgatgatgtcacaattaactagtcggaagaagggt 366

                                                                       
Query: 274 gtagcctatggttcatttaaggtttcaaaggacataaaatatgctgataagcagccaatt 333
            | || ||||| ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 367 atggcgtatggctcatttaaggtttcaaaggacataaaatatgctgataagcagccaatt 426

                                                                       
Query: 334 gtaccatggggaccaaggtttgccaagtccagtatccaagacatgcgcatcaatttggca 393
           ||||||||||||||||||||||||||||||||| ||||||| ||||||||||| ||||||
Sbjct: 427 gtaccatggggaccaaggtttgccaagtccagtgtccaagatatgcgcatcaacttggca 486

                          
Query: 394 atatctggtgcattt 408
           ||||||| |||||||
Sbjct: 487 atatctgctgcattt 501