Jatropha Genome Database

JcCB0078661.20
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0078661.20 - phase: 0 
         (528 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

30131.m007082 Late embryogenesis abundant protein, putative            78   6e-14

>30131.m007082 Late embryogenesis abundant protein, putative
          Length = 570

 Score = 77.8 bits (39), Expect = 6e-14
 Identities = 90/107 (84%)
 Strand = Plus / Plus

                                                                       
Query: 1   atggctgatttaagagatgaatatggcaatccaattcaacttaccgatgaacatggaaat 60
           ||||||||| |||| ||||| | |||||| ||| ||||||| || ||||||||||| || 
Sbjct: 1   atggctgatataagggatgagtttggcaacccagttcaactaactgatgaacatggtaac 60

                                                          
Query: 61  ccagttgaattgaccgatgaacatggcaacccagtgcatataactgg 107
           |||||| |||| || |||||||| || || ||||||||| |||||||
Sbjct: 61  ccagttcaattaacggatgaacagggtaaaccagtgcatctaactgg 107