Jatropha Genome Database
- JcCB0078191.10
BLASTN 2.2.23 [Feb-03-2010]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= JcCB0078191.10 + phase: 1 /partial/short
(104 letters)
Database: castor_wgs_0.1_cds
31,221 sequences; 31,347,911 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
30115.m001208 conserved hypothetical protein 133 2e-31
>30115.m001208 conserved hypothetical protein
Length = 1197
Score = 133 bits (67), Expect = 2e-31
Identities = 95/103 (92%), Gaps = 1/103 (0%)
Strand = Plus / Plus
Query: 1 cggatcggttttcggattcacttcgaaaagccgggtggagctccgaggaagtttcggatg 60
||||||||||||||||||||||||||||||| |||||||||||||| ||||| |||||||
Sbjct: 1028 cggatcggttttcggattcacttcgaaaagctgggtggagctccgaagaagtatcggatg 1087
Query: 61 cattaggatttgattttcgacctgagaaagaaaaggaaaccgg 103
| ||||| |||||||||||||| || |||| ||||||||||||
Sbjct: 1088 ctttagggtttgattttcgaccgga-aaaggaaaggaaaccgg 1129