Jatropha Genome Database
- JcCB0076221.10
BLASTN 2.2.23 [Feb-03-2010]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= JcCB0076221.10 + phase: 0 /partial
(324 letters)
Database: castor_wgs_0.1_cds
31,221 sequences; 31,347,911 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
29953.m000424 phosphatidylethanolamine-binding protein, putative 204 2e-52
29929.m004518 phosphatidylethanolamine-binding protein, putative 145 2e-34
29929.m004520 phosphatidylethanolamine-binding protein, putative 72 2e-12
>29953.m000424 phosphatidylethanolamine-binding protein, putative
Length = 522
Score = 204 bits (103), Expect = 2e-52
Identities = 252/301 (83%), Gaps = 3/301 (0%)
Strand = Plus / Plus
Query: 1 gttatggtggaccccgacgcccctagcccaagtgaccctaatctcagagaatacttgcat 60
|||||||||||||| || || |||||||||||||| || || || ||||||||||||||
Sbjct: 199 gttatggtggaccctgatgcacctagcccaagtgatccaaacctgagagaatacttgcac 258
Query: 61 tggttggtgactgatattccagcaactactggggtaacttttgggcaagagatagtgtgc 120
|||||||||| |||||||||| ||| || |||| |||||||||||||||||| ||||||
Sbjct: 259 tggttggtgatcgatattccaggaaccacaggggcaacttttgggcaagagattgtgtgc 318
Query: 121 tatgagagcccgcgaccatcgttggggattcatcggttcgtatttatattgttccggcag 180
||||| || ||| |||| | | || |||||||| || | ||||||||| || |||||
Sbjct: 319 tatgaaagtccgaatccattgctaggaattcatcgttttgcatttatattatttcggcaa 378
Query: 181 ctgggaaggcagaccgtgtatccaccagggtggcgtcagaatttcaacactagagatttc 240
||||| ||||| || |||||| |||| || |||||||| || |||||||||||||| ||
Sbjct: 379 ctggggaggcaaactgtgtatgcacctggctggcgtcaaaacttcaacactagagacttt 438
Query: 241 gctgagctctacaatcttggttcaccggtggctgctgtttattttaattgccagagggag 300
||||||||||||||||| || ||| || |||||| | ||||| |||||||||||||||
Sbjct: 439 gctgagctctacaatct---tttaccagttgctgctctctatttcaattgccagagggag 495
Query: 301 a 301
|
Sbjct: 496 a 496
>29929.m004518 phosphatidylethanolamine-binding protein, putative
Length = 525
Score = 145 bits (73), Expect = 2e-34
Identities = 244/301 (81%)
Strand = Plus / Plus
Query: 1 gttatggtggaccccgacgcccctagcccaagtgaccctaatctcagagaatacttgcat 60
||||||||||| || ||||| |||| ||||||||| || ||||| |||||||| ||||||
Sbjct: 199 gttatggtggatcctgacgcacctaacccaagtgatccaaatctgagagaatatttgcat 258
Query: 61 tggttggtgactgatattccagcaactactggggtaacttttgggcaagagatagtgtgc 120
||| ||||||||||||| || || | || |||| || ||| || ||||| | || ||
Sbjct: 259 tggctggtgactgatatacctgcgatgacaggggcaagtttcggacaagaagtggtctgt 318
Query: 121 tatgagagcccgcgaccatcgttggggattcatcggttcgtatttatattgttccggcag 180
||||| ||||| ||||| || ||||||| ||||| ||||| || ||||||| ||||
Sbjct: 319 tatgaaagcccaagaccaacggtggggatacatcgcttcgtgttcatattgtataggcaa 378
Query: 181 ctgggaaggcagaccgtgtatccaccagggtggcgtcagaatttcaacactagagatttc 240
||||| |||||||| |||||| |||| || ||||| ||||| |||| ||| ||| ||
Sbjct: 379 ctggggaggcagacagtgtatgcacctggctggcgccagaacttcagtgctaaagacttt 438
Query: 241 gctgagctctacaatcttggttcaccggtggctgctgtttattttaattgccagagggag 300
|||||||| ||||||||||| || || || ||||| || |||||||||||||||||||||
Sbjct: 439 gctgagctttacaatcttggctcgcctgtcgctgcagtctattttaattgccagagggag 498
Query: 301 a 301
|
Sbjct: 499 a 499
>29929.m004520 phosphatidylethanolamine-binding protein, putative
Length = 285
Score = 71.9 bits (36), Expect = 2e-12
Identities = 57/64 (89%)
Strand = Plus / Plus
Query: 1 gttatggtggaccccgacgcccctagcccaagtgaccctaatctcagagaatacttgcat 60
|||||||||||||| || || |||||||||||||| || || || |||||||||||||||
Sbjct: 199 gttatggtggaccctgatgcacctagcccaagtgatccaaacctgagagaatacttgcat 258
Query: 61 tggt 64
||||
Sbjct: 259 tggt 262