Jatropha Genome Database

JcCB0075891.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0075891.10 - phase: 0 /partial
         (430 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

29848.m004627 conserved hypothetical protein                          119   1e-26

>29848.m004627 conserved hypothetical protein
          Length = 1281

 Score =  119 bits (60), Expect = 1e-26
 Identities = 129/152 (84%)
 Strand = Plus / Plus

                                                                       
Query: 263 gatcaaatgtacatgtgggaagcaatggattcactggttctaaggaaggggaattaaaag 322
           ||||||||||||||||||||||||||||||| || |||| |||||||||| |  | ||| 
Sbjct: 185 gatcaaatgtacatgtgggaagcaatggattgacaggttgtaaggaagggaatgtcaaaa 244

                                                                       
Query: 323 atggaagtcagtcagagcaagtcaaatcactgaagggccctggaaagggcaagaatgaaa 382
           |||   |||| |||||||| | ||||||||||||||| ||||||||| |||||| |||||
Sbjct: 245 atgagggtcattcagagcatgccaaatcactgaagggtcctggaaagagcaagagtgaaa 304

                                           
Query: 383 aaccatcaaaccgcaaaactgtctcagccact 414
           |  ||||||||| ||||| |  ||||||||||
Sbjct: 305 agtcatcaaaccccaaaaatacctcagccact 336