Jatropha Genome Database

JcCB0075281.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0075281.10 - phase: 0 
         (489 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

29682.m000579 auxin:hydrogen symporter, putative                       62   3e-09
29682.m000578 auxin:hydrogen symporter, putative                       56   2e-07

>29682.m000579 auxin:hydrogen symporter, putative
          Length = 1344

 Score = 61.9 bits (31), Expect = 3e-09
 Identities = 52/59 (88%)
 Strand = Plus / Plus

                                                                      
Query: 215 tgtggttcatgccattaaatattctcatcacgtttataattggctcaatgcttggatgg 273
           |||||||||||||| | |||||||| ||||| || || |||||||||||||| ||||||
Sbjct: 215 tgtggttcatgccactcaatattcttatcacattcatcattggctcaatgctcggatgg 273


>29682.m000578 auxin:hydrogen symporter, putative
          Length = 1254

 Score = 56.0 bits (28), Expect = 2e-07
 Identities = 76/92 (82%)
 Strand = Plus / Plus

                                                                       
Query: 371 tcccagcaatttgtaaagaaaaaggaagtccatttggagctcccgatgtctgtcagtcat 430
           |||||||||| |||| ||| |||||||||||||||||| | || ||||| || ||  |||
Sbjct: 383 tcccagcaatgtgtagagagaaaggaagtccatttggaccacctgatgtttgccacgcat 442

                                           
Query: 431 atggattggcttatgtttcactctcaatggcg 462
           ||||  |  |||||| |||||| |||||||||
Sbjct: 443 atgggatctcttatgcttcactttcaatggcg 474