Jatropha Genome Database

JcCB0073371.20
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0073371.20 + phase: 0 /partial
         (201 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

30170.m013673 conserved hypothetical protein                          180   2e-45
27496.m000094 conserved hypothetical protein                           68   2e-11
29700.m000761 conserved hypothetical protein                           52   1e-06

>30170.m013673 conserved hypothetical protein
          Length = 1854

 Score =  180 bits (91), Expect = 2e-45
 Identities = 145/163 (88%)
 Strand = Plus / Minus

                                                                       
Query: 1   tttcttgaacgatggcggcccctattcatatgccgctcgcagtacttctggtcggcaact 60
           |||||||||||||| |||||||| |||||||||||||| ||||| |||||||||||||| 
Sbjct: 788 tttcttgaacgatgacggcccctgttcatatgccgctcacagtatttctggtcggcaacc 729

                                                                       
Query: 61  gcatctcttgagcaccgccatttctttccatcagtcctacgacaccgacctggctctgga 120
           ||||||||||||||||||||||| || ||||| ||||| ||||| || || |||||||||
Sbjct: 728 gcatctcttgagcaccgccattttttcccatctgtcctgcgacaacgcccaggctctgga 669

                                                      
Query: 121 tcagtgttgttcgagaacccaagatggaaagtaccccatggca 163
           ||| ||||| | ||||| || |||||||||| |||||||||||
Sbjct: 668 tcattgttgcttgagaaacccagatggaaagcaccccatggca 626


>27496.m000094 conserved hypothetical protein
          Length = 1287

 Score = 67.9 bits (34), Expect = 2e-11
 Identities = 100/122 (81%)
 Strand = Plus / Minus

                                                                       
Query: 1   tttcttgaacgatggcggcccctattcatatgccgctcgcagtacttctggtcggcaact 60
           ||||||||||| | |||||| | ||  | ||| |||||||| ||||||||| | || |||
Sbjct: 617 tttcttgaacggttgcggccacgatgaacatggcgctcgcaatacttctggccagccact 558

                                                                       
Query: 61  gcatctcttgagcaccgccatttctttccatcagtcctacgacaccgacctggctctgga 120
            | || |||||||||| ||||||||| ||||||||||| || ||||| || ||||| |||
Sbjct: 557 acgtcccttgagcacctccatttcttcccatcagtcctccggcaccggccgggctccgga 498

             
Query: 121 tc 122
           ||
Sbjct: 497 tc 496


>29700.m000761 conserved hypothetical protein
          Length = 1440

 Score = 52.0 bits (26), Expect = 1e-06
 Identities = 80/98 (81%)
 Strand = Plus / Minus

                                                                       
Query: 1   tttcttgaacgatggcggcccctattcatatgccgctcgcagtacttctggtcggcaact 60
           |||||||||||  | ||||| || | ||| || ||||| ||||| ||||| || | | | 
Sbjct: 551 tttcttgaacggggacggcctctgtgcatgtgacgctcacagtatttctgatcaggagca 492

                                                 
Query: 61  gcatctcttgagcaccgccatttctttccatcagtcct 98
           ||||||||||| |||| ||||||||||||||| |||||
Sbjct: 491 gcatctcttgaacacctccatttctttccatctgtcct 454