Jatropha Genome Database

JcCB0065721.30
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0065721.30 - phase: 1 /partial
         (329 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

29780.m001348 pentatricopeptide repeat-containing protein, putative   129   1e-29

>29780.m001348 pentatricopeptide repeat-containing protein, putative
          Length = 1350

 Score =  129 bits (65), Expect = 1e-29
 Identities = 131/153 (85%)
 Strand = Plus / Plus

                                                                        
Query: 27   aggataagagatgcaatgaggcttgtgacaaagatgaaagtaaatggctgtgaaccaaat 86
            |||| |||||||||||||||||| ||  | || ||||||||||| || ||||||||||||
Sbjct: 883  aggacaagagatgcaatgaggctcgtagcgaaaatgaaagtaaaggggtgtgaaccaaat 942

                                                                        
Query: 87   gtctggatatacaattttctattagatatgcaaggaagagtcaatagtttgaggcaggta 146
            || |||||||||||||   | || |||||||| || |||||||| |  ||||||||||| 
Sbjct: 943  gtatggatatacaattcattgttggatatgcatgggagagtcaagaacttgaggcaggtg 1002

                                             
Query: 147  gagaagctatggaaagaaatgaagagaaggaaa 179
            |||||||| ||||| ||||||||||||||||||
Sbjct: 1003 gagaagctgtggaaggaaatgaagagaaggaaa 1035