Jatropha Genome Database

JcCB0065691.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0065691.10 - phase: 0 
         (402 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

29908.m006115 conserved hypothetical protein                          212   1e-54

>29908.m006115 conserved hypothetical protein
          Length = 336

 Score =  212 bits (107), Expect = 1e-54
 Identities = 209/243 (86%)
 Strand = Plus / Plus

                                                                       
Query: 1   atggccgccagttcgagccgaggcggttccttctatggcggcgctgctccctatagatcg 60
           ||||||||||||||||||||||  |||| |||||| || || || | |||||||||||| 
Sbjct: 1   atggccgccagttcgagccgagatggtttcttctacggtggtgccgttccctatagatca 60

                                                                       
Query: 61  aaggatgggctcagcacgagaccggcggcgagctccgatgaaatacaattacggattgat 120
           |  || || || | |||||||||||  |  ||||||||||||||||| ||||||||||||
Sbjct: 61  agagaaggacttaccacgagaccggtaggcagctccgatgaaatacagttacggattgat 120

                                                                       
Query: 121 ccgatgcacgctgacttcgatgacgagatctctggtctccgtagccaagttaagcaattg 180
           || |||||||||||||||||||| |||||||| || |||||| ||||||||||||  || 
Sbjct: 121 ccaatgcacgctgacttcgatgatgagatctccggcctccgtggccaagttaagctttta 180

                                                                       
Query: 181 agaaatgtggctcaagagataggatcagaagcaaagttccagaaggatttcttggatcag 240
            ||||||| ||||| |||||||| ||||||||||||||||| || |||||||||||||||
Sbjct: 181 cgaaatgtagctcaggagatagggtcagaagcaaagttccaaaaagatttcttggatcag 240

              
Query: 241 ctg 243
           |||
Sbjct: 241 ctg 243