Jatropha Genome Database

JcCB0059061.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0059061.10 + phase: 0 /partial
         (738 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

30008.m000792 hypothetical protein                                    167   1e-40
30008.m000793 ATP binding protein, putative                           127   1e-28

>30008.m000792 hypothetical protein
          Length = 270

 Score =  167 bits (84), Expect = 1e-40
 Identities = 120/132 (90%)
 Strand = Plus / Plus

                                                                       
Query: 513 gacagatgatcttgaaggccgagtccatgcacatcgatcaaaggaagggatgtataatgc 572
           ||||||||||||||| |||||||| | ||| |||||||||||||| |||||| |||||||
Sbjct: 12  gacagatgatcttgagggccgagttcgtgctcatcgatcaaaggaggggatgcataatgc 71

                                                                       
Query: 573 ctcttttctttatttcatagttaaaggaaagagcattgcttgccaactggaaactcttct 632
            |||||||| ||||| |||||| |||||||||||||||||||||||||||||||||||||
Sbjct: 72  ttcttttctatattttatagttcaaggaaagagcattgcttgccaactggaaactcttct 131

                       
Query: 633 tatcaaccagct 644
            ||||| |||||
Sbjct: 132 aatcaatcagct 143


>30008.m000793 ATP binding protein, putative
          Length = 2814

 Score =  127 bits (64), Expect = 1e-28
 Identities = 98/108 (90%), Gaps = 1/108 (0%)
 Strand = Plus / Plus

                                                                        
Query: 1    atgggaacagaatatgtcaatggacaaacaaaaccaacttggagattgatagatgggatc 60
            |||||||||||||||||  ||||||||||||||||||||||||| |||| |||||| |||
Sbjct: 2704 atgggaacagaatatgttgatggacaaacaaaaccaacttggaggttgagagatggaatc 2763

                                                            
Query: 61   tgtaaagaaagccttgcttttgaaaccgcaaagaagg-aagggatccc 107
            ||||  |||||||||||||||||||| ||||||| || ||||||||||
Sbjct: 2764 tgtagggaaagccttgcttttgaaacagcaaagagggaaagggatccc 2811