Jatropha Genome Database

JcCB0057531.20
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0057531.20 - phase: 1 /pseudo/partial
         (417 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

30074.m001366 amino acid transporter, putative                         68   4e-11

>30074.m001366 amino acid transporter, putative
          Length = 1386

 Score = 67.9 bits (34), Expect = 4e-11
 Identities = 116/142 (81%), Gaps = 1/142 (0%)
 Strand = Plus / Plus

                                                                        
Query: 266  gcaaacaaatatcaaaagaggaagctgtcgttggatgtgttttcaggctatgagtttagt 325
            |||| |||| ||||| ||||| ||| |||||||| || ||||||| ||| |||| || ||
Sbjct: 1233 gcaagcaaacatcaagagagggagcagtcgttgggtgagttttcaagctttgagcttggt 1292

                                                                        
Query: 326  tctgtatgaattttactttcatttctggcataggttcagttgcaggtgtttcagagagtc 385
            | |||  || | | ||| ||||||| ||  ||||||||||||| ||| | | ||||||||
Sbjct: 1293 t-tgtgggattgtcactctcatttcaggtttaggttcagttgctggtatgttagagagtc 1351

                                  
Query: 386  ttaagaaagcgaagctatttca 407
            |||||||||| |||||||||||
Sbjct: 1352 ttaagaaagccaagctatttca 1373