Jatropha Genome Database
- JcCB0056061.10
BLASTN 2.2.23 [Feb-03-2010]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= JcCB0056061.10 - phase: 0
(216 letters)
Database: castor_wgs_0.1_cds
31,221 sequences; 31,347,911 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
29602.m000209 rac gtpase, putative 111 2e-24
29912.m005491 rac gtpase, putative 103 4e-22
30170.m014385 rac gtpase, putative 76 9e-14
29900.m001556 rac gtpase, putative 72 1e-12
30147.m013989 rac gtpase, putative 58 2e-08
28962.m000460 rac gtpase, putative 52 1e-06
29646.m001113 rac gtpase, putative 50 5e-06
>29602.m000209 rac gtpase, putative
Length = 597
Score = 111 bits (56), Expect = 2e-24
Identities = 83/92 (90%)
Strand = Plus / Plus
Query: 1 atgagtgcttctaggttcattaaatgcgtcacagttggtgatggtgctgttggcaagact 60
||||||||||| |||||||| || || || || |||||||| ||||||||||||||||||
Sbjct: 1 atgagtgcttcaaggttcataaagtgtgttactgttggtgacggtgctgttggcaagact 60
Query: 61 tgcatgctcatctcctacaccagcaacacttt 92
|| ||||| |||||||||||||||||||||||
Sbjct: 61 tgtatgcttatctcctacaccagcaacacttt 92
>29912.m005491 rac gtpase, putative
Length = 630
Score = 103 bits (52), Expect = 4e-22
Identities = 79/88 (89%)
Strand = Plus / Plus
Query: 1 atgagtgcttctaggttcattaaatgcgtcacagttggtgatggtgctgttggcaagact 60
||||||||||| | |||||||||||| || |||||||| |||||||||||||||||||||
Sbjct: 1 atgagtgcttccaagttcattaaatgtgttacagttggagatggtgctgttggcaagact 60
Query: 61 tgcatgctcatctcctacaccagcaaca 88
|| |||||||| | |||||||||||||
Sbjct: 61 tgtatgctcatttgttacaccagcaaca 88
>30170.m014385 rac gtpase, putative
Length = 594
Score = 75.8 bits (38), Expect = 9e-14
Identities = 83/98 (84%)
Strand = Plus / Plus
Query: 1 atgagtgcttctaggttcattaaatgcgtcacagttggtgatggtgctgttggcaagact 60
||||| || ||| |||||||||| |||||||| || || || || ||||| |||||||||
Sbjct: 1 atgagcgcctctcggttcattaagtgcgtcaccgtcggcgacggcgctgtcggcaagact 60
Query: 61 tgcatgctcatctcctacaccagcaacacttttcctac 98
|||||||| || || ||||| ||||||||||| |||||
Sbjct: 61 tgcatgcttatttcttacactagcaacactttccctac 98
>29900.m001556 rac gtpase, putative
Length = 594
Score = 71.9 bits (36), Expect = 1e-12
Identities = 69/80 (86%)
Strand = Plus / Plus
Query: 19 attaaatgcgtcacagttggtgatggtgctgttggcaagacttgcatgctcatctcctac 78
||||| |||||||| || || ||||| ||||| || ||||||||||||||||| || |||
Sbjct: 19 attaagtgcgtcactgtaggggatggggctgtaggaaagacttgcatgctcatttcttac 78
Query: 79 accagcaacacttttcctac 98
|| ||||| |||||||||||
Sbjct: 79 actagcaatacttttcctac 98
>30147.m013989 rac gtpase, putative
Length = 636
Score = 58.0 bits (29), Expect = 2e-08
Identities = 80/97 (82%)
Strand = Plus / Plus
Query: 4 agtgcttctaggttcattaaatgcgtcacagttggtgatggtgctgttggcaagacttgc 63
|||||||| |||||||| || || || ||||| || ||||||||||| ||||| || |||
Sbjct: 10 agtgcttccaggttcatcaagtgtgtgacagtaggagatggtgctgtaggcaaaacctgc 69
Query: 64 atgctcatctcctacaccagcaacacttttcctactg 100
||||| || | |||||| || |||| ||||||||||
Sbjct: 70 atgcttatttgctacactagtaacaagtttcctactg 106
>28962.m000460 rac gtpase, putative
Length = 594
Score = 52.0 bits (26), Expect = 1e-06
Identities = 62/74 (83%)
Strand = Plus / Plus
Query: 25 tgcgtcacagttggtgatggtgctgttggcaagacttgcatgctcatctcctacaccagc 84
|||||||| |||||||||||||| ||||| || |||||| | | || || |||||||||
Sbjct: 25 tgcgtcacggttggtgatggtgccgttggtaaaacttgccttttgatttcttacaccagc 84
Query: 85 aacacttttcctac 98
||||| || |||||
Sbjct: 85 aacaccttccctac 98
>29646.m001113 rac gtpase, putative
Length = 594
Score = 50.1 bits (25), Expect = 5e-06
Identities = 46/53 (86%)
Strand = Plus / Plus
Query: 34 gttggtgatggtgctgttggcaagacttgcatgctcatctcctacaccagcaa 86
||||||||||| || ||||| ||||| ||||||||||| || ||||| |||||
Sbjct: 34 gttggtgatggagcggttggaaagacatgcatgctcatttcttacacgagcaa 86