Jatropha Genome Database
- JcCB0055861.10
BLASTN 2.2.23 [Feb-03-2010]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= JcCB0055861.10 - phase: 0
(189 letters)
Database: castor_wgs_0.1_cds
31,221 sequences; 31,347,911 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
29838.m001690 mads box protein, putative 50 5e-06
>29838.m001690 mads box protein, putative
Length = 186
Score = 50.1 bits (25), Expect = 5e-06
Identities = 61/73 (83%)
Strand = Plus / Plus
Query: 86 tcaagaaagcttacgaactttctactttatgtgatattgagattgctcttatcgtctttt 145
||||||||||||| ||||| || ||| | |||||| |||||| |||||| | |||||||
Sbjct: 86 tcaagaaagcttatgaactatcaactctttgtgatgctgagatagctcttttagtctttt 145
Query: 146 ctcctgctggaaa 158
|| || |||||||
Sbjct: 146 ctgctactggaaa 158