Jatropha Genome Database
- JcCB0053361.10
BLASTN 2.2.23 [Feb-03-2010]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= JcCB0053361.10 + phase: 2 /partial/short
(118 letters)
Database: castor_wgs_0.1_cds
31,221 sequences; 31,347,911 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
28152.m000896 conserved hypothetical protein 92 8e-19
28152.m000897 conserved hypothetical protein 82 8e-16
30169.m006299 conserved hypothetical protein 80 3e-15
>28152.m000896 conserved hypothetical protein
Length = 183
Score = 91.7 bits (46), Expect = 8e-19
Identities = 64/70 (91%)
Strand = Plus / Plus
Query: 11 gagggcaccgcgtcaggctggcttcacagagcagcgataacctctcactcctggcagtgg 70
|||||||| |||| ||||||| |||||||||||||||||||||| | ||| |||||||||
Sbjct: 82 gagggcacagcgttaggctggtttcacagagcagcgataacctccctctcttggcagtgg 141
Query: 71 aaggataacg 80
||||||||||
Sbjct: 142 aaggataacg 151
>28152.m000897 conserved hypothetical protein
Length = 306
Score = 81.8 bits (41), Expect = 8e-16
Identities = 65/73 (89%)
Strand = Plus / Minus
Query: 11 gagggcaccgcgtcaggctggcttcacagagcagcgataacctctcactcctggcagtgg 70
|||||||| |||| ||||||| ||||||||||||||| |||||| ||| |||||||||
Sbjct: 126 gagggcacagcgtgaggctggtttcacagagcagcgacaacctcctgctcttggcagtgg 67
Query: 71 aaggataacgagt 83
|||||||||||||
Sbjct: 66 aaggataacgagt 54
>30169.m006299 conserved hypothetical protein
Length = 309
Score = 79.8 bits (40), Expect = 3e-15
Identities = 61/68 (89%)
Strand = Plus / Plus
Query: 11 gagggcaccgcgtcaggctggcttcacagagcagcgataacctctcactcctggcagtgg 70
||||| ||||||||||||||||||||||||||||||| |||||| | ||| ||| ||||
Sbjct: 242 gagggtaccgcgtcaggctggcttcacagagcagcgacaacctccctctcacggcggtgg 301
Query: 71 aaggataa 78
||||||||
Sbjct: 302 aaggataa 309