Jatropha Genome Database
- JcCB0052451.10
BLASTN 2.2.23 [Feb-03-2010]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= JcCB0052451.10 + phase: 1 /partial/short
(140 letters)
Database: castor_wgs_0.1_cds
31,221 sequences; 31,347,911 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
29583.m000188 Iron-sulfur assembly protein IscA, chloroplast pre... 186 2e-47
>29583.m000188 Iron-sulfur assembly protein IscA, chloroplast
precursor, putative
Length = 537
Score = 186 bits (94), Expect = 2e-47
Identities = 127/138 (92%)
Strand = Plus / Plus
Query: 3 tgtgacccaaagagccttctcttcctatttgggatgcaattggattatagtgatgctcta 62
||||| ||||||||||| |||||| ||||||||||||||||||||||||||||||| ||
Sbjct: 397 tgtgatccaaagagcctcctcttcgtatttgggatgcaattggattatagtgatgcctta 456
Query: 63 attgggggaggtttctcttttaagaacccaaatgctacacaaacgtgtggttgtggtaaa 122
||||| |||||||||||||||||||||||||||||||||||||| ||||| || ||||||
Sbjct: 457 attggtggaggtttctcttttaagaacccaaatgctacacaaacatgtggctgcggtaaa 516
Query: 123 tcatttgcagcagagatg 140
|| ||||| |||||||||
Sbjct: 517 tcctttgctgcagagatg 534