Jatropha Genome Database

JcCB0049611.20
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0049611.20 - phase: 0 /partial/short
         (135 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

28124.m000248 conserved hypothetical protein                           82   9e-16

>28124.m000248 conserved hypothetical protein
          Length = 1161

 Score = 81.8 bits (41), Expect = 9e-16
 Identities = 65/73 (89%)
 Strand = Plus / Plus

                                                                        
Query: 1    atggccgatgacttggttacatttgatggaggataccagatgacattattacctggaggc 60
            ||||| ||||||||||| |||||||| |||||||| || || || |||||||| ||||||
Sbjct: 931  atggcagatgacttggtaacatttgaaggaggatatcaaattactttattaccaggaggc 990

                         
Query: 61   atgtacatgggat 73
            |||||||||||||
Sbjct: 991  atgtacatgggat 1003