Jatropha Genome Database

JcCB0045901.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0045901.10 + phase: 1 /partial/short
         (146 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

30204.m001815 conserved hypothetical protein                           88   2e-17

>30204.m001815 conserved hypothetical protein
          Length = 378

 Score = 87.7 bits (44), Expect = 2e-17
 Identities = 116/140 (82%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttcttccagtgaaattcaaagcgctttgagggatgaaagtctcaggaaacttatacgta 60
           |||||||||||||||||   | ||| |||| ||||||||||||  ||||||||||| || 
Sbjct: 170 cttcttccagtgaaatttgcaacgcattgaaggatgaaagtcttcggaaacttatatgtg 229

                                                                       
Query: 61  gcattgattctgctgcagatccagaaagtgaacttgaaaaagctatgggggtcgaggcat 120
             ||||||  |||| |||||||||| || |||||||| ||||||||||| || || ||||
Sbjct: 230 ctattgatgatgcttcagatccagatagcgaacttgagaaagctatgggagtggaagcat 289

                               
Query: 121 tccgcatcttcactgacaag 140
           || | ||||| |||||||||
Sbjct: 290 tctgtatctttactgacaag 309