Jatropha Genome Database

JcCB0041131.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0041131.10 + phase: 0 /pseudo
         (703 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

29904.m002958 conserved hypothetical protein                          174   5e-43

>29904.m002958 conserved hypothetical protein
          Length = 801

 Score =  174 bits (88), Expect = 5e-43
 Identities = 149/168 (88%), Gaps = 6/168 (3%)
 Strand = Plus / Plus

                                                                       
Query: 409 aatgagagtaaggatttgggcattga---ggcttcgtttggggaaaatgttttggacatt 465
           ||||||||||||||||||||  ||||   |||||| ||||| |||||||| ||||| |||
Sbjct: 466 aatgagagtaaggatttgggtgttgaagaggcttcttttggagaaaatgtgttggatatt 525

                                                                       
Query: 466 gaaggtagagagaggagcactagggaatccactccttgcagtttgataagggacccagaa 525
           ||||||||||| || |||||||||||||| |||||||||||||||||| |||||||||| 
Sbjct: 526 gaaggtagagaaagtagcactagggaatcaactccttgcagtttgatacgggacccagag 585

                                                           
Query: 526 accataagaacccctggttcgactactagaccaaccagctcaactgaa 573
           | |||||||||||||||||| ||||||||||   ||||||||||||||
Sbjct: 586 agcataagaacccctggttcaactactagac---ccagctcaactgaa 630



 Score =  103 bits (52), Expect = 1e-21
 Identities = 73/80 (91%)
 Strand = Plus / Plus

                                                                      
Query: 4  aggaaggcaaaaacgacaggcgaggttgccgttatggacctctctcttggcgtccgtacc 63
          |||||||| |||||||||  |||||||||||| |||||||||||| | || |||||||||
Sbjct: 16 aggaaggccaaaacgacatccgaggttgccgtcatggacctctctttcggtgtccgtacc 75

                              
Query: 64 cgcgccaaaaccctagctct 83
          ||||||||||||||||||||
Sbjct: 76 cgcgccaaaaccctagctct 95