Jatropha Genome Database

JcCB0034671.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0034671.10 + phase: 0 
         (261 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

29970.m000991 conserved hypothetical protein                           72   2e-12

>29970.m000991 conserved hypothetical protein
          Length = 258

 Score = 71.9 bits (36), Expect = 2e-12
 Identities = 113/138 (81%), Gaps = 3/138 (2%)
 Strand = Plus / Plus

                                                                       
Query: 120 ggacaaaggtttctttgatggattgtttcttggtgccattaagcaatcaggaccaagccc 179
           ||||||||||||||||||||| |||| | ||||||| || ||||||||||| || || ||
Sbjct: 120 ggacaaaggtttctttgatgggttgtctattggtgcaatcaagcaatcaggtcccagtcc 179

                                                                       
Query: 180 aggacaagggaataggttaactgattctcggagttttggaggcattaataaggatggtcc 239
           ||||   || || |  |  || ||||| ||| ||||||| || ||   ||||||||||||
Sbjct: 180 aggagcgggtaacaaatacacagattcacggggttttgggggaat---taaggatggtcc 236

                             
Query: 240 tagccctggacagggaca 257
           ||||||||||||||||||
Sbjct: 237 tagccctggacagggaca 254