Jatropha Genome Database

JcCB0033901.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0033901.10 - phase: 0 /pseudo/partial
         (210 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

29709.m001212 nucleolar GTP-binding protein, putative                  76   9e-14

>29709.m001212 nucleolar GTP-binding protein, putative
          Length = 1332

 Score = 75.8 bits (38), Expect = 9e-14
 Identities = 65/74 (87%)
 Strand = Plus / Plus

                                                                       
Query: 85  cctatggtgatgccatcagttgacatattttattcagcactgaggaaggccaaaagggtc 144
           ||||||||||||||||| ||||| ||  ||||||| ||| | ||||||||||||||||||
Sbjct: 271 cctatggtgatgccatctgttgatattctttattctgcattaaggaaggccaaaagggtc 330

                         
Query: 145 ccacctacaaaagg 158
            |||| ||||||||
Sbjct: 331 tcacccacaaaagg 344