Jatropha Genome Database

JcCB0031431.20
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0031431.20 - phase: 0 
         (333 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

29629.m001436 RALFL33, putative                                       182   9e-46

>29629.m001436 RALFL33, putative
          Length = 345

 Score =  182 bits (92), Expect = 9e-46
 Identities = 166/190 (87%), Gaps = 3/190 (1%)
 Strand = Plus / Plus

                                                                       
Query: 140 ttgaagaggcagagatggagtcagagatcagcaggagagttcttttgatgcaaaag---t 196
           |||||||| | || |||||||||||||||||||||||||||||| |||||||||||   |
Sbjct: 149 ttgaagagccggaaatggagtcagagatcagcaggagagttcttgtgatgcaaaagaagt 208

                                                                       
Query: 197 atataagctacgagacattgaagagagacatggttccatgtgcaaagccaggagcctctt 256
           | ||||| || |||||||||||||| || |||||||||||||  || ||||| || ||||
Sbjct: 209 acataagttatgagacattgaagagggatatggttccatgtgacaaaccaggtgcatctt 268

                                                                       
Query: 257 actatgattgtcatgctggagaagctaatccttacagcagaggttgcgaggtcattacaa 316
           |||||||||||||||||||||| |||||||||||||| |||||||| ||  | |||||||
Sbjct: 269 actatgattgtcatgctggagaggctaatccttacagtagaggttgtgaaatgattacaa 328

                     
Query: 317 gatgtagagg 326
           | ||||||||
Sbjct: 329 ggtgtagagg 338



 Score = 56.0 bits (28), Expect = 1e-07
 Identities = 40/44 (90%)
 Strand = Plus / Plus

                                                      
Query: 46 acccatttcgcaatttgtaatggggtttcagtttcaggcctcaa 89
          |||| |||| ||||||| ||||||||||||||||||||| ||||
Sbjct: 46 acccttttcacaatttgcaatggggtttcagtttcaggcttcaa 89