Jatropha Genome Database

JcCB0029801.20
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0029801.20 + phase: 1 /partial/short
         (104 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

29748.m000392 zinc finger protein, putative                           103   2e-22

>29748.m000392 zinc finger protein, putative
          Length = 1041

 Score =  103 bits (52), Expect = 2e-22
 Identities = 85/95 (89%), Gaps = 2/95 (2%)
 Strand = Plus / Plus

                                                                       
Query: 12  attgccatgattgcgccaaatgtgttcttcattttgatcatcactgtgttcggcttggaa 71
           ||||||||||||| | ||||||||||||||| ||||||||||| || ||| |||||||||
Sbjct: 536 attgccatgattgtgacaaatgtgttcttcagtttgatcatcattgcgtttggcttggaa 595

                                              
Query: 72  catgcattggtcagg--aatcattgtcgattttgg 104
           | |||||||| ||||  ||||||||||||||||||
Sbjct: 596 cgtgcattggccagggaaatcattgtcgattttgg 630