Jatropha Genome Database

JcCB0025551.30
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0025551.30 - phase: 1 /partial
         (308 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

29739.m003769 conserved hypothetical protein                          363   e-100
27798.m000597 conserved hypothetical protein                           58   3e-08

>29739.m003769 conserved hypothetical protein
          Length = 2055

 Score =  363 bits (183), Expect = e-100
 Identities = 270/299 (90%)
 Strand = Plus / Plus

                                                                        
Query: 1    ttgcacttcagagcgatgtatttgtatatacgtatgatgaaaatatggcaaaggcagttc 60
            |||||||||| || ||||||||||| | ||| ||||||| ||||||||||||||||||||
Sbjct: 1610 ttgcacttcaaagtgatgtatttgtttttacctatgatggaaatatggcaaaggcagttc 1669

                                                                        
Query: 61   aaggtcataggcgatttgaggactttaagaagactatcaatccagacaaggtgaattttg 120
            |||||||||| |||||||||||||| ||||| ||||| || ||||||||| |||||||||
Sbjct: 1670 aaggtcatagacgatttgaggacttcaagaaaactattaacccagacaagatgaattttg 1729

                                                                        
Query: 121  tgaaacttgtggatgagttggatgaaggaaaaatatcttgggagacattcagttctgaag 180
            ||||||| ||||| |||||||||||||| |||||||| |||||| | ||||||||  |||
Sbjct: 1730 tgaaactagtggacgagttggatgaagggaaaatatcatgggagtcgttcagttccaaag 1789

                                                                        
Query: 181  tgaaagaacttcacaaagatcgaatcggagctccatatcaaagggagcccggagagtttc 240
            ||||||| |||||||||||| || | || |||||||||| ||||||||| ||||||||||
Sbjct: 1790 tgaaagagcttcacaaagatagagttggtgctccatatctaagggagcctggagagtttc 1849

                                                                       
Query: 241  caaagctggaggaaagtttttatgcaaatccccttccaggatgtatttgtgaaagaaca 299
            |||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||
Sbjct: 1850 caaaactggaggaaagtttttatgcaaatccccttccaggatgtatttgtgaaacaaca 1908


>27798.m000597 conserved hypothetical protein
          Length = 1857

 Score = 58.0 bits (29), Expect = 3e-08
 Identities = 41/45 (91%)
 Strand = Plus / Plus

                                                         
Query: 27   tatacgtatgatgaaaatatggcaaaggcagttcaaggtcatagg 71
            ||||| ||||||| ||||||||||||||||||||| || ||||||
Sbjct: 1513 tatacatatgatggaaatatggcaaaggcagttcaggggcatagg 1557