Jatropha Genome Database

JcCB0023791.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0023791.10 + phase: 0 /partial
         (336 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

30174.m009078 protein binding protein, putative                        90   1e-17

>30174.m009078 protein binding protein, putative
          Length = 672

 Score = 89.7 bits (45), Expect = 1e-17
 Identities = 114/137 (83%)
 Strand = Plus / Plus

                                                                       
Query: 104 atttatatgcttcccaggatgatgaagatgtttgccccacatgtcttgaagattatagct 163
           |||| ||||||||||  || ||||| ||||| ||||||||||| || ||||| || |  |
Sbjct: 464 atttctatgcttcccttgacgatgaggatgtctgccccacatgcctagaagagtacactt 523

                                                                       
Query: 164 ttgataatccaaggatagtgacacattgccagcaccatttccatcttggatgtatatatg 223
           ||||||||||  ||||||||||| | ||| ||||||||| ||| ||||| ||||||||||
Sbjct: 524 ttgataatccgcggatagtgacagaatgcaagcaccattaccaccttggttgtatatatg 583

                            
Query: 224 agtggatggaaagaagc 240
           | |||  ||||||||||
Sbjct: 584 aatggcaggaaagaagc 600